First Mushroom
Date: 05/08/2010
Habitat: Specimen found growing alone on ground, near rotten wood and under a tulip tree ("tulip poplar").
Measurements:
Stipe (stem) length - 5.0 cm
Stipe diameter at apex - 2.0 cm
Stipe diameter at middel - 1.2 cm
Stipe diameter at base - 1.5 cm
Pileus (cap) diameter - 7.7 cm
Pileus legth - 1.5 cm
Description:
Hymenius (under side of the cap) is comprised of tightly attached tubes with round, white, pores, which do not bruise any color. Tubes are shallow (1-1.5 mm).
Stipe is central, solid, white, cartilagionous (brakes with a snap), when cut one can see small fibrils on border and dots inside, smell is agreeable but not distinctive. More importantly, stipe is radicated (continues as if it had a root) and pseudorhiza (root-like structure) is dark, convoluted and with multiple knots. Pseudorhiza is about 5 cm long. No ring (ring of tissue in stipe), veil (tissue covering pore surface) or volva (ring of tissue at stem base) were observed.
Spore print: could not obtain one.
Impressions: Given that specimen has "roots", spore surface is tightly attached and that it was found alone and near decaying woods, it suggests that this speciment is a Polyporus radicatus (Schwein.) Fr. The important things for identification here are the combination of a ground growing polypore with dark, convoluted pseudorhiza and thin tightly attached tubes. This is not an edible mushroom.
Note: After sequencing the intergenic region 1 (ITS1) of this mushroom I got a 98% match to Polyporus tuberaster. Apparently there is no sequence deposited for Polyporus radicatus and these two polyporus are very similiar to each other.
The sequence obtained was: GCCGAWCCGCAAGGAACCAAGCTAATGCATTTGAGAGGAGTCGACAATCGCCGACAAAAGCCTCCAAAGTCCAAGCCTTACAAAGACCACAAGGATCTTGCAGGTTGAGAATTTCATGACACTCAAACAGGCGTGCTCCTCGGAATGCCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCA
See the result of the BLAST below:
gb|AF516594.1| Polyporus tuberaster CulTENN10316 SBI 1 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length=988 Score = 573 bits (310), Expect = 2e-160 Identities = 330/340 (97%), Gaps = 2/340 (0%) Strand=Plus/Plus Query 3 ATTCAGTGAATCATCGAATCTTTGAMCGCACCTTGCGCTCCTTGGCATTCCGAGGAG-AG 61 ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| | Sbjct 627 ATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCAC 686 Query 62 GACTGTTTGAGTGTCATGAAATTCTCAACCTGCAAGATCCTTGTGGTCTTTGTAAGGCTT 121 | ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| Sbjct 687 GCCTGTTTGAGTGTCATGAAATTCTCAACCTGCGAGATCCTTGTGGTCTTTGTAAGGCTT 746 Query 122 GGACTTTGGAGGCTTTTGTCGGCGATTGTCGACTCCTCTCAAATGCATTAGCTTGGTTCC 181 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 747 GGACTTTGGAGGCTTTTGTCGGCGATTGTCGACTCCTCTCAAATGCATTAGCTTGGTTCC 806 Query 182 TTGCGGATCGGCTTTCGGTGTGATAGTTGTCTACGCCGTGACCGTGAAGCGTTTTGACTA 241 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | Sbjct 807 TTGCGGATCGGCTTTCGGTGTGATAGTTGTCTACGCCGTGACCGTGAAGCGTTTTGGCGA 866 Query 242 GCTTCTAATCGTCTCGTTCGAGACTCATTCTTCATTGACATCTGACCTCAAATCAGGCGG 301 |||||||| |||||||||||||||| ||||||||| |||||||||||||||||||||||| Sbjct 867 GCTTCTAACCGTCTCGTTCGAGACTTATTCTTCAT-GACATCTGACCTCAAATCAGGCGG 925 Query 302 GACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA 341 |||||||||||||||||||||||||||||||||||||||| Sbjct 926 GACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA 965
No comments:
Post a Comment