Unindentified Mushroom

I found these ones growing in large numbers on the ground and on top of dead wood.

Date: 05/30/2010
Location: Rockville, MD
Habitat: Growing in a cluster in the woods (near Woodmont Country Club)

Measurements
Stipe length - 81 mm
Stipe diameter at base: 7.5 mm wide, 4.5 mm thick
Stipe diameter at middle: 7.5 mm wide, 4.5 mm thick
Stipe diameter at apex: 7.5 mm wide, 4.5 mm thick
Pileus height: 17 mm
Pileus diameter: 37mm  x 27 mm

Description
Pileus - parabolic, round, light beige, dull, smooth, glabrous, unicolorous, margin is entire, plane.
Hymenium - gilled, adnate, gills are light brown, subdistant, soft, smooth, narrow
Stipe - central, equal, hollow, flexible, white, glabrous, compressed, inserted

Spore print - brown

Impressions
The most striking characteristic of this specimen was the was the equal and compressed white stipe. I have no idea what it could be and therefore will submit it to Mushroom Observer to get some ideas and will post the result of the discussion here later.

Mushroom Observer Comments
Dave W and Douglas Smith suggested that this could be a Psathyrella, most probably Psathyrella candolleana. According to Michael Kuo's Mushroom Expert, this mushroom is very variable in color and in habitat and it is very difficult to identify Psathyrellas without microscopic analysis. Therefore it may be safer to call this one just Psathyrella sp. Most probably I should type it by sequencing but the mushroom has already deteriorated (it almost disappeared after leaving it outside of the fridge over night).

A nice red lawn mushroom

This is another mushroom found on my last (and productive) walk around the block. I had seen it before, always growing on grass as solitary specimens. This time I collected two or three that were growing a couple feet from each other, to examine them closely. This mushroom has a nice purple colored cap that contrasts nicely with its white and uplifted gills.

Date: 05/30/2010
Location: Rockville, MD

Habitat


Solitary, growing on grass

Measurements
Pileus height - 9 mm
Pileus diameter - 36 mm
Stipe length - 30 mm
Stipe diameter at apex - 10.5 mm
Stipe diameter at middle - 10.5 mm
Stipe diameter at base - 13.5 mm

Description
Pileus - dry, somewhat cracked and with some dirt on top, red/purple color, flat/narrowly depressed, margin is uplturned, crisped. Semi-round. Smell is non-distinctive. Taste is somewhat peppery.
Hymenium- gilled, white, sub-distant, adnexed, moderately broad, smooth

Stipe - central, hollow with spongy like content, slightly large at base, white, soft, inserted

Spore print - didn't manage to obtain one


Impressions
To me this specimens look like one of the many red Russulaceae. It has many of the features of the poisonous Russula emetica (the sickener) but it could also be the edible R. pulchra Burlingham (see: Roody W.C., Pg 230). Alternatively it could be either the poisonous R. mairei (beechwood sickener), R. atropurpurea or R. luteotacta. By now, the attentive reader may have figured out that identifying Russulacea is not easy and that therefore eating them is not advisable, specially the red ones. For now I'll call these specimens above just Russula sp.

Agaricus campestris (Meadow Mushroom)

This weekend I went to Assateague Island with my family and friends and was excited with the possibility of finding some different species. Apparently the sandy, salty soil and the windy conditions at Assateague are not very friendly to mushrooms and I did not see any there (not even Polypores). After we returned I decided to do my walk around the block to see what was going on around here during my absence and see if any new things were growing on my regular path. To my surprise, I found multiple specimens from at least seven different species (A. muscaria, P. fonisecii, S. rugoso-annulata and four others which I'll blog about). The first one follows below:

Date:05/30/2010

Habitat
Two specimens near each other, growing on grass (one with bite marks on the surface of the pileus)

Measurements
Pileus diameter - 25-29 mm | 37 mm
Pileus height- 10 mm | 12 mm
Stipe length - 23 mm | 41 mm
Stipe diameter at apex  - 7 mm  | 8 mm
Stipe diameter at middle- 6 mm | 7.7 mm
Stipe diameter at base - 6 mm | 6.7 mm

Description
Pileus - white color, convex, round, unicolorous, margin is plane and entire, cuticle is dull, dry, smooth, glabrous. Smell is not distinctive. No volva. Does not bruise any color.

Hymenium - Gilled. Remnants of partial veil present on hymenium in one.  Gills are close, light brown color with pink hue on first day but turning darker brown on second, narrow, smooth, free.

Stipe - central, almost equal, solid (with little caniculli and wholes on inner part), slightly tapered at base, white/cream color, inserted, glabrous, does not bruise any color, no volva, ring visualized in one of the two specimens (12 mm from hymenium)

Spore print - dark brown

Spores - eliptical and smooth. No apical pore visualized under 400X.


Impression
These specimens looks like some sort of Agaricus, most probably A. campestris L. (Meadow mushroom). The important thing here to distinguish it from other members of the Agaricacea family would be the fact that this one does not bruise yellow and that it does not have any distinctive smell (a phenolic smell would suggest A. xanthodermis). A. abruptibulbus and A. arvensis bruise yellow but have an anise-like odor but as the name of the former already suggests, it has an abrupt bulb at the stipe base. If this were the case, this mushroom would be edible and a good. A. campestris is a close relative of the "white button mushroom" (A. bisporus)  that is commercially produced and can be found on all supermarkets around the country.  Last, one should be extra extra careful not to mistake A. campestris with Amanita virosa, which has a sac-like volva at the stalk base, white gills that do not change color and white spores.

I am not brave enough to eat gilled mushrooms yet and therefore would not suggest beginners (like me) trying it.

A toothed polypore

On my previous post I mentioned that on my last "foray" around the block I found a mushroom, which I couldn't identify, and that I had posted it on Mushroom Observer to fish for some clues of what it could be (by the way, in my opinion this is the best way to get multiple opinions on the identity of a specimen). One day later, Darvin DeShazer from the Sonoma County Mycological Association saw it and suggested that it could be a Spongipellis pachyodon ( Pers.) Kotl. and Pouz. According to the Wikipedia, the Spongipellis genus is widely distributed, it is a member of the Polyporacea family and it has eight species. In spite of their wide distribution, none of the Spongipellis were listed on any of my field guides (i.e. Mushrooms of West Virginia and the Appalachians and the Central Appalachians or The Falcon Guide to North American Mushrooms).

Date:23/05/2010

Habitat: Growing on wood (live tree) in large clusters near each other. Multiple solitary individuals also present in the same tree.


Description: Imbricate (growing directly from the tree, without a stipe), large clusters > 10 cm of diameter, smaller individuals solitaru and < 1 cm. Cuticle is pulverulent, rugose, light gray with a dark beige margin. Hymenium with cream colored spines, soft and with flat ends (not pointy)

Impression: Although I think this mushroom does look like a member of the Spongipellis family, as you can see on my photo, the specimen in question in not white and it has a darker margin, which could suggest that it is another species (or not - I am not sure about this). Since I am a novice amateur mycologist, I was surprised with the idea that Polypores could be toothed and, for some reason, I had the naive impression that a mushroom either had teeth or pores (apparently one can have both). According to Michael Kuo's Mushroom Expert, this fungi is a parasite that "causes a white heart rot in living trees throughout eastern North America". Roger Mushrooms describe it as being crust-like or spreading on surface of logs, frequently with many smaller patches or caps fused together into sheets, but suggests that it grows on fallen logs of maple, beech and oak (not the case here). Both sites describe the cuticle as being tomentose ("finely velvety") but, while Kuo describe the color as being "white to dull yellowish", Roger Mushrooms describe it as being "cream colored".

This mushroom is not edible (I imagine that it is too hard to eat anyway).

A Jelly Mushroom

Today, after the rain, I decided to go for a short walk around the block to breath some fresh air, relax, and to see what kind of mushrooms I could find. Since it rained quite a lot over the last couple of days the grass was full of Panaeolus fonisecii (see previous post about this mushroom).  Apart from that, I ended finding two interesting mushrooms. One of them I could not identify (submitted to the Mushroom Observer website). The other I could at least determine the genera, and I have some pretty good idea of what it could be (I am not 100% sure though). Since this is the first jelly mushroom I found, I was quite excited but, if I weren't into mushrooms, I would probably find it very yucky and run from it fast, for it looks like some sort of alien creature directly from the x-files.


Date: 05/23/2010

Location: Rockville, MD (East Jefferson St)
Habitat: Growing on a dead tree, near a brook, forming large clusters that were less than 50 cm from each other (gregarious)

Description: This mushroom does not have a stipe (stem) and grows attached to the tree, it is jelly-like (soft and wet at touch), dark brown, wrinkled, amorphous (this is important to separate it from Auricularia auricula - a.k.a. Jelly ear). The clusters were sometimes larger than 10 cm of diameter. It has no odor and, because I was not brave enough to try it, I can't say anything about its taste ;-)

Impression: This is definitely not a jelly-ear mushroom (since it is not ear shaped and it is too amorphous to be called an ear). To me, it looks like one of the many members of the genera Tremella (most probably Tremella foliacea). Because of the very dark brown color (the photo is not very accurate and in reality it is much darker than depicted) I find it difficult to ascertain the species. At least we can exclude the very common Tremella mesenterica (which is usually pale yellow  to golden yellow).   Given the atypical dark color, the fact that I do not have a microscope at home, and that it is somewhat difficult to obtain a spore print, I am going to call this one only Tremella sp. (although I almost feel like calling it Tremella foliacea). According to The Falcon Guide to North American Mushrooms, if it were really T. foliacea, it would be edible, but it has no taste and have an awful jelly texture.

Note:  Dan Molter pointed out at my post at the Mushroom Observer that this mushroom could be Exidia recisa (Ditmar) Fr (a.k.a. Amber jelly roll). I am not sure yet, but it is a good possibility since Exidia has been described as having colors varying from yellowish-brown to cinnamon-brown (see description at Mushrooms of Northeastern North America) which fit better with the specimen appearance. Best way to be sure would be to look the mushroom under the microscope (which I may do later this week). Keep in mind that if indeed it were Exidia, then this would be a fungi of unknown edibility. See more information on Exidia here (identificationkey), here (microscopic anatomy) and here (wikipedia entry).

Wine-cap

Today, while day dreaming during work, I spotted one of these mushrooms from my window growing on the mulch across the street. First I must say that my building is quite distant from the sidewalk, and that the mushroom was on the other side of the street, and on the other side of the sidewalk (i.e. far away). What got my attention was the bright cap reflecting the afternoon sun and the thick white stem that popped out from the dark mulch. Once I saw it (or I thought I saw it) I was decided to stop by after work and check if I was suffering from delirium fungi ;-) or if it was really true that I could see a mushroom from that far.  To my surprise (or not) it wasn't one mushroom, but in fact, it was a cluster of seven or more individuals on the recently applied mulch. Given that there were mushrooms at multiple stages I decided to collect three (one small, one medium and one large) and bring them home. Below are my notes:

Date: 05/20/2010
Habitat: Urban, growing on mulch, gregarious

Measurements
Stipe (stem) length - 6.0 | 9.0 | 13.0 cm
Stipe diameter apex - 2.0  | 2.0 | 3.0 cm
Stipe diameter at middle - 2.5 | 2.5 | 4.0 cm
Stipe diameter at base - 3.5 | 4.0 | 5.0 cm
Pileus (cap) diameter - 6.5 | 9.0 | 14.0 cm
Pileus height - 1.0 | 1.5 | 2.0 cm

Description
Pileus convex to plane, irregular (with bumps) and shallowly depressed, margin incurved, purple/brown, surface dry but shiny, with cracks showing white flesh below cuticle, flesh is firm, white/turning light yellow with time, hymenium is gilled, lamela are close, soft, grey/purple, adnexed.

Stipe - clavate, solid, white inside, beige with longitudinal striations on the outside and below the annulus, white above the annulus, annulus located 1.5-2.0 cm from pileus, curly and painted purple/grey on top due to spores, partial veil present on younger specimen, white colored. Odor is non-distinctive.

Spore print - purple/grey

Impressions
These specimens seem to be from Stropharia rugoso-annulata Farl. ex Murill species. It is also called wine-cap and is a member of the Agaricales order (Family Strophariaceae). This nice-looking mushroom is a common urban inhabitant that usually grows in mulch or soil and which is a good edible. Roody suggests that it is better eaten when young, since older specimens are "unappealing". As a cautionary note, one should remember that all gilled mushrooms can be mistaken my potentially lethal lookalikes and that, therefore, one should not take lightly the importance of being 100% sure of the identify of such mushrooms before eating them. Michael Kuo in his book "100 Edible Mushrooms" suggests that one should make sure that 100% of the expected characteristics are observed (in doubt, throw out). Please refer to those books (and others) if you feel like eating any mushroom.

Little brown mushroom (LBM)

It's been raining for the last two or three days here in Rockville and the soil is quite humid. Walking to work today I found a large number of little brown mushrooms growing on the lawn around the sidewalks (Woohoo!). They were very fragile and in the morning they looked like as having a dark brown ring towards the border of the pileus (cap). I took some photos and collected some specimens to have a look later. I kept some in my jacket's pocket and I carried one in my hand, just in case. The one I carried on my hand changed color and became a darker brown, specifically on the region where I was holding it. Below are my notes on these little ones:


Date: 05/18/2010

Location: Rockville, MD

Habitat
Growing on grass in groups of 5-10 individuals (gregarious) near the sidewalk.

Measurements
Stipe length - 6.0 cm
Stipe diameter - 2 mm
Pileus height - 1.5 cm
Pileus diameter - 2.0 cm


Description
Pileus - Conical, glabrous (bald), soft, light brown with darker edge (bicolorous) when fresh but single colored (light brown/grey) after loosing humidity. Hymenium is gilled and cinnamon cinnamon brown color. Lamella are free and well spaced, lamelulla are present near the edge but do not continue for more than a few millimiters. Border is entire. Smell is non-distinctive (I did not taste it ;-).
Stipe - Centrally attached, light brown/silverish, hollow, fibrous (when cut apart separates in thin strings),  straight and equal, no ring, volva or anulus observed. Inserted.
Spore print - purple/brown
Spores - dark yellow under the microscope, elliptical and with a apical germ pore (at 400x)



Impression
This is most probably a specimen of Panaeolus foenisecii (Pers.) J. Schrot,. also known as Lawn Mower's Mushroom. This mushroom is a common urban inhabitant that grows in lawns, specially after rain, and it does not last more than one day. It is possibly poisonous and according to some may contain low levels of hallucinogenic compounds (psilocybin and psilocin). As a curiosity, according to Roody's Mushrooms of West Virginia and the Central Appalachians, foenisecii is derived from the latin word meaning "mower" or "harvester".

All Panaeolus have conic to campanulate pileus, thin stipe and generate purple-brown spores (sincerely I can't see where is the purple) with apical germ pore.  They usually grow on grass or dung.

Second Polypore

As mentioned on the previous post, last weekend I went mushroom picking I found two polypores (and only that). Polypores are mushrooms characterized by the presence of many pores (hence the name) under the cap. They usually grow on wood but can also grow from the ground.

I already described the first mushroom recently, so here goes the second:

Habitat:  this specimen was found growing on a fallen branch close to other two individuals from the same species (gregarious).


Measurements:
Pileus - Fan shaped with 4 cm of length and 7 cm of width.
Stipe - Very short, 0.5 cm of diameter.




Description:
Pileus - Pileate, cream/orange cuticle, appresed fibrilose (short hair compressed against cuticle), margin is fringed, plane, surface is dull, smell is not distinctive, flesh is soft.

Hymenium - with hexagonal shaped pores, pores are large, cream colored, margin is orange/brown


Stipe - lateral and very small, solid, white colored.

Spore print - I could not obtain one.


Impressions: The characteristics of this specimen fit the description of Polyporus mori pollini, which is an edible mushroom with tough flesh. The name mori refers to Morus alba (white mulberry) where the species was first collected. Recently the name of this mushroom has been changed to Polyporus alveolaris.

Reference: Roody WC. Mushrooms of West Virginia and Central Appalachians, pg 363.

Two polypores

Today I went to Wheaton Regional Park (Maryland) to pick mushrooms in the woods. The park is a good spot for morels in the first weeks of the spring and it has a good size and good terrain, which includes hills covered with hard wood and pine, a lake, many brooks and some lawn covered areas, therefore allowing a large variety of mushrooms to grow. For those with family, the park offers barbecue areas, a carousel for the kids, bike paths and an ice ring (which was closed). Although the foray wasn't the most productive I managed to find a variety of old and hard polypores in decaying wood and two fresh specimens, one of which I'll describe below (the other I'll save for later).

First Mushroom

Date: 05/08/2010
Habitat:  Specimen found growing alone on ground, near rotten wood and under a tulip tree ("tulip poplar").

Measurements:
Stipe (stem) length - 5.0 cm
Stipe diameter at apex - 2.0 cm
Stipe diameter at middel - 1.2 cm
Stipe diameter at base - 1.5 cm
Pileus (cap) diameter - 7.7 cm
Pileus legth - 1.5 cm

Description:
Pileus cuticle (surface) brown and with a darker edge, with fine, short, soft and sparse fibrils (hair), margin is eroded and incurved (rolled downward), surface is dull, flesh is soft, white. Smell is not distictive but slightly sweet. Pileus is uplifted and shallowly depressed (center of pileus is deeper than borders). From the top, pileus is round. Taste is bland and not distinctive.
Hymenius (under side of the cap) is comprised of tightly attached tubes with round, white, pores, which do not bruise any color. Tubes are shallow (1-1.5 mm).

Stipe is central, solid, white, cartilagionous (brakes with a snap), when cut one can see small fibrils on border and dots inside, smell is agreeable but not distinctive. More importantly, stipe is radicated (continues as if it had a root) and pseudorhiza (root-like structure) is dark, convoluted and with multiple knots. Pseudorhiza is about 5 cm long. No ring (ring of tissue in stipe), veil (tissue covering pore surface) or volva (ring of tissue at stem base) were observed.
Spore print: could not obtain one.

Impressions: Given that specimen has "roots", spore surface is tightly attached and that it was found alone and near decaying woods, it suggests that this speciment is a Polyporus radicatus (Schwein.) Fr. The important things for identification here are the combination of a ground growing polypore with dark, convoluted pseudorhiza and thin tightly attached tubes. This is not an edible mushroom.


Note: After sequencing the intergenic region 1 (ITS1) of this mushroom I got a 98% match to Polyporus tuberaster. Apparently there is no sequence deposited for Polyporus radicatus and these two polyporus are very similiar to each other.

The sequence obtained was: GCCGAWCCGCAAGGAACCAAGCTAATGCATTTGAGAGGAGTCGACAATCGCCGACAAAAGCCTCCAAAGTCCAAGCCTTACAAAGACCACAAGGATCTTGCAGGTTGAGAATTTCATGACACTCAAACAGGCGTGCTCCTCGGAATGCCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCA

See the result of the BLAST below:

gb|AF516594.1|  Polyporus tuberaster CulTENN10316 SBI 1 18S ribosomal RNA gene, 
partial sequence; internal transcribed spacer 1, 5.8S ribosomal 
RNA gene and internal transcribed spacer 2, complete 
sequence; and 28S ribosomal RNA gene, partial sequence
Length=988

 Score =  573 bits (310),  Expect = 2e-160
 Identities = 330/340 (97%), Gaps = 2/340 (0%)
 Strand=Plus/Plus

Query  3    ATTCAGTGAATCATCGAATCTTTGAMCGCACCTTGCGCTCCTTGGCATTCCGAGGAG-AG  61
            ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| | 
Sbjct  627  ATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCAC  686

Query  62   GACTGTTTGAGTGTCATGAAATTCTCAACCTGCAAGATCCTTGTGGTCTTTGTAAGGCTT  121
            | ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct  687  GCCTGTTTGAGTGTCATGAAATTCTCAACCTGCGAGATCCTTGTGGTCTTTGTAAGGCTT  746

Query  122  GGACTTTGGAGGCTTTTGTCGGCGATTGTCGACTCCTCTCAAATGCATTAGCTTGGTTCC  181
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  747  GGACTTTGGAGGCTTTTGTCGGCGATTGTCGACTCCTCTCAAATGCATTAGCTTGGTTCC  806

Query  182  TTGCGGATCGGCTTTCGGTGTGATAGTTGTCTACGCCGTGACCGTGAAGCGTTTTGACTA  241
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
Sbjct  807  TTGCGGATCGGCTTTCGGTGTGATAGTTGTCTACGCCGTGACCGTGAAGCGTTTTGGCGA  866

Query  242  GCTTCTAATCGTCTCGTTCGAGACTCATTCTTCATTGACATCTGACCTCAAATCAGGCGG  301
            |||||||| |||||||||||||||| ||||||||| ||||||||||||||||||||||||
Sbjct  867  GCTTCTAACCGTCTCGTTCGAGACTTATTCTTCAT-GACATCTGACCTCAAATCAGGCGG  925

Query  302  GACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA  341
            ||||||||||||||||||||||||||||||||||||||||
Sbjct  926  GACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA  965

Book Review - 100 Edible Mushrooms by Michael Kuo

Although this book has been around since 2007, only recently I got a copy of Michael Kuo's 100 Edible Mushrooms (with tested recipes). The book has the same humorous tone of Michael's Morels and the same editorial quality. This paperback edition is printed in nice, thick, glossy paper, and it has hundreds of nice photos. The book is an easy read and I imagine that one could possibly read it from cover to cover very easily (although it will be more useful as a reference book). To me the book doesn't look like it is intended to be a field guide, given the size and weight, but I think it could possibly be used as such (it is a heavy field guide though). The book text is basically divided in three sections, based on how much experience Mr. Kuo deems necessary for someone to identify each of the mushrooms. The first section is composed of the mushrooms which are "easy" to identify, followed by the ones that "require experience", with the last section being dedicated to the ones which are "difficult". Although the book is appropriately named 100 Edible mushrooms, there is also a section on poisonous/toxic look alikes (which I consider very useful) and according to the author, in total there are much more than 100 mushrooms on the book (I did not count). The book has some very good features as for instance, the fact that for each of the mushrooms covered on the book the authors present data on identification, habitat photos and culinary information (including recipes at the end of the book). Although the information on the book is very nice, I am not sure one could identify with certainty all the mushrooms on the book using only the information provided by the authors and a few more detailed photos would be a good addition to it. Also, although the books tries to highlight some of the important aspects of mushroom identification through "focus points" it would be much better if, for each mushroom, a small table pointing out the required characteristics (which must be present or absent from each mushroom) was available.

Last, although I have to admit that I am not that experienced to judge properly the author's classification system for easy, medium and difficult to identify species, if anything, it looks like the book errs on the safe side, placing some mushrooms which are considered easy to identify on the medium difficulty chapter. For example, Mr. Kuo places the hen of the woods (Grifola frondosa), most puff balls and most boletes (except for the giant puff ball Calvatia gigantea and the parasitic bolete Boletus parasiticus) as mushrooms requiring experience, while in Alexander Schwab's Mushrooming Without Fear they are classified as being easy to identify and recommend to beginners. Obviously both authors have good reasons for their choices but I imagine that Mr. Kuo is a little bit more cautious, specially with species that could be mistaken for lethal ones (even it this is very improbable).

All in all, Michael Kuo "100 Edible Mushrooms" is a very nice book, fun to read and full of great information for both the novice and expert amateur mycologist. You can buy the book for US$18.45 at Amazon.com by clicking on the link above or by going to our Amazon partner store, Mushroomer. Have fun!

The tools of the trade

Mushroom picking is a great hobby for many reasons, but given the current global economic crisis, one of the major benefits is that it is almost free and requires very little financial investment (maybe this is the reason why it is such a popular hobby in Russia). One could say that with a lot less than US$50, it is possible to acquire all 'necessary' gadgets (note the quotes in necessary). Indeed, one does not need much to join the select group of mushroomers around the globe (actually - not so select), and I would say that the only two things that are really necessary are the membership to a mycological club in your area or a good mushroom field guide. Although I used 'or' instead of 'and', I think that, whenever possible, getting both things is the best idea since there is no good substitute for knowledge and experience. So, here are the tools of the trade:

1) Field Guide
A good field guide will teach you how to and help you identify some of the mushrooms you are going to find in the woods and lawns around your house. Very rapidly you'll see that you may end needing more than one guide and, in my opinion, collecting field guides may be a hobby by itself. These nice books are filled with identification keys and many beautiful photos which you'll want to browse many times. Given the huge variety of mushrooms in the world, no field guide will allow you to identify all the mushrooms you find, which may add some extra emotion to the hobby (if you are really lucky and good you may even identify new species). Some good options for North American mushroom field guides are the Falcon Guide - North American Mushrooms, the National Audubon Society Field Guide to North American Mushrooms and the A Field Guide to Mushrooms: North America (Peterson Field Guide). For those interested in edible mushrooms, 100 Edible Mushrooms by Michael Kuo is a very good start. The approximate cost of a decent field guide is US$15.

2) A pocket knife
You will need a small knife to help you dig and cut your mushrooms in the woods. It is a good idea to use a knife to help you remove the whole mushroom from the ground, specially when you are learning about identification. Many mushrooms have parts which stay under the ground (volvas can be hidden under the earth) and which can be essential for proper identification. Also, some mushrooms have features like hollow stipes (stipe is the same as stem in mycologese) which need to be cut open to be properly examined. Last, if you are picking mushrooms for the kitchen you will want to remove dirt and little creatures that may be living on your findings before taking them home. Although, any pocket knife will do the job, if you want to impress your friends, you can buy a mycology pocket knife, which comes with a a small brush attached to one end which can be used to clean your mushrooms. If you choose the cheap option, it will cost you approximately US$5-6 and if you choose the expensive one, it costs around US$35.

3) Paper bags or basket
Mushrooms don't like to be kept in plastic bags and they can go bad very fast if you do it. Most mushroomers use either paper bags or baskets to keep their findings. The advantage of the paper bag is that you can take notes about the mushroom (e.g. habitat and location) on the bag itself, reducing the chance of you forgetting the important details of a particular specimen. The advantage of the basket is that you can keep many mushrooms on it at the same time (although you risk over-doing on the mushroomer look). I usually carry both with me when I am in the woods. Some people improvise their baskets by cutting old milk bottles or plastic containers and, if you are into recycling, it may be a good idea (plus - it is totally free). A bag of brown paper sandwich bags costs approximately US$2 and usually comes with 50 units.

4) Insect repellent
Unless your skin is thicker than mine and you don't mind the mosquito bites and ticks, I highly suggest spraying some DEET on your clothes. DEET is very cheap and may reduce the risk of you getting the wrong bug. Although the risk is low, I've heard of people getting Lyme disease by mushroom picking in the woods around DC. A bottle of DEET costs around US$8.

5) A walking stick
Some people prefer to buy fancy "professional" looking walking sticks but since I am advertising mushroom picking as a cheap hobby, I would suggest finding a nice long and straight stick in the forest (there are plenty in the ground) and claiming it for yourself. It is free and works the same (total cost US$0).

6) A magnifying glass
This item is optional but it may help you (specially if you don't have super high acuity) see small features in mushrooms. This is very important since discrete characteristics of mushrooms can be important identification clues. Since I am not the most oriented person on earth, I bough myself a compass, which conveniently came with a magnifying glass on it. It costs less than US$5 and it solves two problems at the same time. If you have the money, a GPS is not a bad idea either...

In conclusion, with US$35 dollars or less you are ready to start picking your mushrooms and enjoying hundreds of hours of fresh air in the woods (or just around the block). Furthermore, once you get good at identifying mushrooms, and if you are brave enough, you can start collecting edible mushrooms (morels are a good start since there aren't many poisonous look-alikes), and save some money on you grocery bill.

Last, if you decide to join a mycological club, it can cost around US$20/year and It is totally worth the money. If you want to buy any of the items listed here, you can just follow the links or buy them at The Mushroomer Store (an Amazon.com partner) following the link on the top right corner or clinking here.

First Mushroom

This being my first blog about mushrooms, I'll try to explain why I am doing this and why I decided to start it.

It all starts with my wife suggesting that I should get myself a hobby. It's been many, many years since I practiced any sport regularly or did any sort of activity (apart from working and reading) consistently. My wife's primary idea was to get me out of home and do something healthy (a.k.a enjoy life). Being some sort of nerd, of course, I chose something that had some science involved. Strangely, I don't know exactly why I chose mushrooms, but I ended finding the Mycological Association of Washington website and decided to join. Since then, I have gone to a few forays, which I enjoyed greatly, and have started to collect any mushrooms I find around my building when I go out with my wife and daughter for our daily walks.

That said, my primary objective here is to try to log my mushroom encounters and see if I can help/get helped with mushroom identification. As a cautionary note I should mention that I have just started picking mushrooms and that my first morel season was this year. Although I am interested in edible mushrooms (as most people are), I am also interested in just learning more about all fungi. Also, being a scientist, I have a few advantages over other people in regards to mushroom identification since I can sequence certain genes to fingerprint them (although in my experience, this does not necessarily provides a definitive answer). So...let's start.

First Mushroom log
Date: 05/08/2010
Location: Rockville, MD

Measurements
Stipe length: 7.0 cm
Stipe diameter at apex: 1.7 cm
Stipe diameter at middle: 2.0 cm
Stipe diameter at base: 2.7 cm
Pileus diameter: 4.0 cm
Pileus heigth: 2.7 cm

Description
Pileus - Cream colored, convex, orbicular (ovoid), bicolorous, margin entire, surface dull, dry, covered with scales/warts which are slightly raised but not pointed, smell is not distinctive, there is no latex, lamella (gills) seem adnexed, crowded, narrow, smooth. The pileus surface bruises orange/red.
Stipe - Central, inserted, clavate, rugose at the base but not at middle or apex, white colored at middle and apex but brown at base, solid, bruises yellow at top (only), consistency is cartilaginous (breaks with firm split), does not have veil, volva or anulus (stature pluteotoid).
Spore print - Did not obtain it.

Habitat
Solitary and growing on grass.

Impression
Because it was found on grass, it has gills, no volva or universal veil remnants, it has a clavate stipe that bruises orange/red, to me it suggests that it could be a Leucoagaricus americanus, but because I did not find an annulus (ring) I am not 100% sure about it. The fact that I did not manage to obtain a spore print also does not help. I will probably have to resort to sequencing the ITS region or asking someone more experienced to confirm this. If this isthe case, it would be an edible, but given that I am not sure about this, I wouldn't suggest anyone trying to eat similar mushrooms (actually I don't suggest anyone using my blog to identify mushrooms since this is just a personal log).

Further Impressions
After submitting my photos to Mushroomobserver.com I got some feedback from other fellow amateur mycologists pointing out that it looks like there are remnants of the universal veil (ring) on the pileus which I did not spot and that this mushrooms looks like an Amanita (unidentified species). I am still open to more feedback and will post the ITS1 sequencing results as soon as I get it.

Final Results of ITS sequencing
After sequencing the intergenic spacer region 1 (ITS1) and querying the results against the nr database using NCBI Blastn I got 100% of similarity with Amanita muscaria. Therefore, the fellow mycologists from Mushroom Observer were right. Be advised that this is a poisonous mushroom that contains hallucinogenic compounds and therefore it should not be eaten.

For those with some molecular biology background

The sequence obtained was: gccagggctgcctacaagcagtgcacaagtggagagaatgaagaaacaagcaagagagacaacgg

The best match for the ITS1 sequence is available here.